HiLobrow is pleased to present the fifth and final installment of our serialization of “The Comet,” a 1920 science fiction story by W.E.B. DuBois, the most important black protest leader in the United States during the first half of the 20th century. “The Comet” was originally published as the tenth chapter of Du Bois’s avant-garde fiction, poetry, and autobiographical collection Darkwater: Voices From Within the Veil.

SUBSCRIBE to HiLobrow’s serialized fiction via RSS.

ALL EXCERPTS: 1 | 2 | 3 | 4 | 5

He did not glimpse the glory in her eyes, but stood looking outward toward the sea and sending rocket after rocket into the unanswering darkness. Dark-purple clouds lay banked and billowed in the west. Behind them and all around, the heavens glowed in dim, weird radiance that suffused the darkening world and made almost a minor music. Suddenly, as though gathered back in some vast hand, the great cloud-curtain fell away. Low on the horizon lay a long, white star — mystic, wonderful! And from it fled upward to the pole, like some wan bridal veil, a pale, wide sheet of flame that lighted all the world and dimmed the stars.

In fascinated silence the man gazed at the heavens and dropped his rockets to the floor. Memories of memories stirred to life in the dead recesses of his mind. The shackles seemed to rattle and fall from his soul. Up from the crass and crushing and cringing of his caste leaped the lone majesty of kings long dead. He arose within the shadows, tall, straight, and stern, with power in his eyes and ghostly scepters hovering to his grasp. It was as though some mighty Pharaoh lived again, or curled Assyrian lord. He turned and looked upon the lady, and found her gazing straight at him.

Silently, immovably, they saw each other face to face — eye to eye. Their souls lay naked to the night. It was not lust; it was not love — it was some vaster, mightier thing that needed neither touch of body nor thrill of soul. It was a thought divine, splendid.

Slowly, noiselessly, they moved toward each other — the heavens above, the seas around, the city grim and dead below. He loomed from out the velvet shadows vast and dark. Pearl-white and slender, she shone beneath the stars. She stretched her jeweled hands abroad. He lifted up his mighty arms, and they cried each to the other, almost with one voice, “The world is dead.”

“Long live the —”

“Honk! Honk!” Hoarse and sharp the cry of a motor drifted clearly up from the silence below. They started backward with a cry and gazed upon each other with eyes that faltered and fell, with blood that boiled.

“Honk! Honk! Honk! Honk!” came the mad cry again, and almost from their feet a rocket blazed into the air and scattered its stars upon them. She covered her eyes with her hands, and her shoulders heaved. He dropped and bowed, groped blindly on his knees about the floor. A blue flame spluttered lazily after an age, and she heard the scream of an answering rocket as it flew.

Then they stood still as death, looking to opposite ends of the earth.

“Clang — crash — clang!”

The roar and ring of swift elevators shooting upward from below made the great tower tremble. A murmur and babel of voices swept in upon the night. All over the once dead city the lights blinked, flickered, and flamed; and then with a sudden clanging of doors the entrance to the platform was filled with men, and one with white and flying hair rushed to the girl and lifted her to his breast. “My daughter!” he sobbed.

Behind him hurried a younger, comelier man, carefully clad in motor costume, who bent above the girl with passionate solicitude and gazed into her staring eyes until they narrowed and dropped and her face flushed deeper and deeper crimson.

“Julia,” he whispered; “my darling, I thought you were gone forever.”

She looked up at him with strange, searching eyes.

“Fred,” she murmured, almost vaguely, “is the world — gone?”

“Only New York,” he answered; “it is terrible — awful! You know, — but you, how did you escape — how have you endured this horror? Are you well? Unharmed?”

“Unharmed!” she said.

“And this man here?” he asked, encircling her drooping form with one arm and turning toward the Negro. Suddenly he stiffened and his hand flew to his hip. “Why!” he snarled. “It’s — a — nigger — Julia! Has he — has he dared —”

She lifted her head and looked at her late companion curiously and then dropped her eyes with a sigh.

“He has dared — all, to rescue me,” she said quietly, “and I — thank him — much.” But she did not look at him again. As the couple turned away, the father drew a roll of bills from his pockets.

“Here, my good fellow,” he said, thrusting the money into the man’s hands, “take that, — what’s your name?”

“Jim Davis,” came the answer, hollow-voiced.

“Well, Jim, I thank you. I’ve always liked your people. If you ever want a job, call on me.” And they were gone.

The crowd poured up and out of the elevators, talking and whispering.

“Who was it?”

“Are they alive?”

“How many?”

“Two!”

“Who was saved?”

“A white girl and a nigger — there she goes.”

“A nigger? Where is he? Let’s lynch the damned —”

“Shut up — he’s all right — he saved her.”

“Saved hell! He had no business —”

“Here he comes.”

Into the glare of the electric lights the colored man moved slowly, with the eyes of those that walk and sleep.

“Well, what do you think of that?” cried a bystander; “of all New York, just a white girl and a nigger!”

The colored man heard nothing. He stood silently beneath the glare of the light, gazing at the money in his hand and shrinking as he gazed; slowly he put his other hand into his pocket and brought out a baby’s filmy cap, and gazed again. A woman mounted to the platform and looked about, shading her eyes. She was brown, small, and toil-worn, and in one arm lay the corpse of a dark baby. The crowd parted and her eyes fell on the colored man; with a cry she tottered toward him.

“Jim!”

He whirled and, with a sob of joy, caught her in his arms.

Stay tuned!

RADIUM AGE SCIENCE FICTION: “Radium Age” is HiLobrow’s name for the 1904–33 era, which saw the discovery of radioactivity, the revelation that matter itself is constantly in movement — a fitting metaphor for the first decades of the 20th century, during which old scientific, religious, political, and social certainties were shattered. This era also saw the publication of genre-shattering writing by Edgar Rice Burroughs, Sax Rohmer, E.E. “Doc” Smith, Jack London, Arthur Conan Doyle, Aldous Huxley, Olaf Stapledon, Karel Čapek, H.P. Lovecraft, Charlotte Perkins Gilman, Yevgeny Zamyatin, Philip Gordon Wylie, and other pioneers of post-Verne/Wells, pre-Golden Age “science fiction.” More info here.

HILOBOOKS: The mission of HiLoBooks is to serialize novels on HiLobrow; and also, as of 2012, operating as an imprint of Richard Nash’s Cursor, to reissue Radium Age science fiction in beautiful new print editions. So far, we have published Jack London’s The Scarlet Plague, Rudyard Kipling’s With the Night Mail (and “As Easy as A.B.C.”), Arthur Conan Doyle’s The Poison Belt, H. Rider Haggard’s When the World Shook, Edward Shanks’ The People of the Ruins, William Hope Hodgson’s The Night Land, J.D. Beresford’s Goslings, E.V. Odle’s The Clockwork Man, and Cicely Hamilton’s Theodore Savage. For more information, visit the HiLoBooks homepage.

READ: Jack London’s The Scarlet Plague, serialized between January and April 2012; Rudyard Kipling’s With the Night Mail (and “As Easy as A.B.C.”), serialized between March and June 2012; Arthur Conan Doyle’s The Poison Belt, serialized between April and July 2012; H. Rider Haggard’s When the World Shook, serialized between March and August 2012; Edward Shanks’ The People of the Ruins, serialized between May and September 2012; William Hope Hodgson’s The Night Land, serialized between June and December 2012; J.D. Beresford’s Goslings, serialized between September 2012 and May 2013; E.V. Odle’s The Clockwork Man, serialized between March 2013 and July 2013. ; and Cicely Hamilton’s Theodore Savage, serialized between March and August 2013.

READ: HiLobrow’s previous serialized novels, both original works: James Parker’s The Ballad of Cocky The Fox (“a proof-of-concept that serialization can work on the Internet” — The Atlantic) and Karinne Keithley Syers’s Linda Linda Linda. We also publish original stories and comics.

Illustration, original to HiLobrow, by Joe Alterio

A pungent miasma circulated the basement; a stench that told a story of Ruffles, Coke, Twizzlers, and sweat. The source of the odor came from a round table in the center of the basement, and around it sat four champions of good and their dungeon master; in the center of the table sat a dozen rulebooks for Dungeons and Dragons. The clatter of dice resounded through the room as the game passed through day and night, and eventually passing over a seven hour game session. These champions of good, called Tim, Hayden, Kyle, and Xavier had delved into the deepest dungeons, had slain many vile beasts and other nefarious enemies, all of which set forth by Dean the Dungeon Master. In normal life, the five boys were ostracized to a lesser degree in Middle School due to their hobbies and pursuits, such as Lord of the Rings or Star Trek; anything along such lines received repugnance from the majority of the school. It was only Dean’s parents that had tolerated this hobby of theirs, so it was in Dean’s basement that they played in every Saturday.

Despite this repugnance, the boys continued delving into Dean’s world and playing the adventures he created or the modules they bought, ever attracted by the glint of gold and sanctuary from society. However, the boys did not enter this world of fantasy as themselves. Tim became Timotaíne, a human wizard who coveted power and was followed by his raven familiar. Hayden became Haldr, a strong-built human warrior of Nordic descent who wielded a magical blade and shield. Kyle had named his agile elven ranger after a character in the Lord of the Rings: Celeborn. Xavier changed to the dwarf skald Adrik, who acted as the group’s leader. Their character sheets were worn from years of play; graffiti, creases, and stains were scattered about each like Dean’s own dice… of which he had dozens.

Dean returned from the bright world above, a fresh bag of Ruffles in each hand. “Champions! This night we feast,” he exclaimed. His bounty was welcomed with hardy cheers from the boys sitting around the worn wooden table. “Those were some good encounters before, really sucked me into your game, Dean. God, I needed an escape like that; my parents really haven’t been all that great recently,” announced Tim to the party, “But hopefully I can get some better roles this turn… I’ve had rotten luck!” he added. All felt Tim’s anguish; each of the boys were kicked around at school, but to have difficulties with parents was just the cherry on top of the sundae. Tim’s statement rang true for all of them and their hardships: this was a healthy escape.

Dean took his seat and raised the Dungeon Master screen, which blocked the prying eyes of the players, and resumed their place after a vicious orc ambush. Now their break had ended, their rations of Ruffles refreshed, and they saluted Dean’s American banner hanging on the west wall before playing again.

The chilling winds of the North bit the four companions as they trudged up the path thick with years of snow. The blood that had lined Haldr’s blade had long since frozen from the ambush not an hour ago. The mountain peak continued to tower above, making their quarry seem utterly hopeless no matter how far they trekked. Adrik’s gravelly voice sounded over the shrieking winds “The thoughts of treasure will keep you warm, gentlemen. The distance between us and him grows minimal.” Celeborn, whose light feet slid effortlessly over the snow, responded “Ha, I will carve myself a new cloak from his icy scales!” This received grunts of approval from the whole company. No birds flew these winds, and no winter hares or deer bounded through the white blankets; it was completely desolate of life, the area being nigh unbearable of sustained existence with the presence of the terror atop the mountain peak.

“Timotaíne, can you alleviate this thrice-damned storm?” Haldr howled. Yet with all of his magic, Timotaíne could not give remedy to the situation; he only knew that it was at the hands of an opposing magic-user. “Nay, it is a foul voice that carries the wind along.”

Tim sighed and began drumming his fingers on the table. “Dean, my Wisdom score is 25… that’s insanely good and you know it! Why can’t I block the wind? It’s slowing us down and giving us an Endurance skill check every round, too.”

“Sorry man, but the dice say that the dragon’s Arcana skill given bonus really helps out anything I roll for him attack-wise. You all might just have to deal with it.”

“Great. You know, you’re starting to sound like my folks.”

Xavier intervened before any bad emotions spilt forth. “Hey it’s all good, Tim! Adrik can just use his axe as a shovel and help clear the snow out from ahead like Gandalf did with his staff in the Fellowship, or Haldr can take point and use his shield to block some of the wind.”

“To Kord with it all!” roared Haldr as he braced his shield against the wind as maelstrom waves break upon a lone spire along the shore. Adrik and Celeborn cheered on their companion and marched behind in his wake, free from the wind; it was Timotaíne who would not easily allow himself to be triumphed over by any dragon or companion alike. When the time came, Timotaíne decided that he would be the one to give the killing blow to the dragon.

“Celeborn, what do you hear with your elven ears?”

Dean’s dice clattered on the table. “Kyle, what is Celeborn’s Perception skill?”

“18.”

“You pass the Perception check, and hear—”

Tim’s lip curled in anger, his face turning a slight pink. “Oh but of course when Kyle makes any skill check he passes, huh Dean? Kyle’s parents love him.” A foul and confused expression passed Kyle’s face. Sure, his parents loved him, but did his school crush Cheyenne love him or even acknowledge his existence? Did ‘Butch the Bull’, a notorious bully, ever cease to plague him with mocked questions about hobbits, as well as convincing a number of kids like him to do the same? The answer was no, but Kyle loved his friend as kin and remained silent.

“Tim, his elven racial traits gi—”

“Whatever, just keep rolling your dice…”

Celeborn lifted his head to the sky, his eyes closed, his long golden hair pushed back by the evening breeze. They were silent, only the sound of the desolate mountain ringing in their ears. “His breathing is sporadic, but he dares not move. He lies in ambush. Companions, whatever hope we had in surprising the worm is gone!” Haldr swore to his Norse gods underneath his breath, and Adrik took a long pull of dwarven ale from his ram horn travel-tankard. “We knew it was to be a hard fight… Alright, I’ll go in first, Haldr comes in at my side, with Celeborn and Timotaíne providing a good wall of spells and arrows. Good?” The companions agreed. They unsheathed weapons, readied spellcraft, and notched arrows. They charged the maw of the cave and found themselves in a vast cavern with walls of pure ice, bodies of old champions and trophies of the dragon frozen into them. The cavern was lined with gold, its shine dulled to a dark yellow in the lack of light; but behind the beast is where most of it was piled.

Adrik and Haldr ducked underneath its legs and belly, slashing and weaving with axe and sword, blood spilling freely from tender slits between scales. Arrows ricocheted off his wings and hide, rarely finding a weakness. Timotaíne had a fireball spell set, but he had to get closer to the dragon to ensure a hit! He ran forward, his feet occasionally sliding on the ice. “ADRIK! HALDR! OUT OF THE WAY!” he yelled, and lowered his staff towards the torso of the opponent. They rolled out to the side, and a bright flame began to grow at the end of Timotaíne’s staff. However, the dragon was old and experienced with such heroic types; and he had tasted fire magic, to his displeasure. The dragon, with unperceived agility, reached forward with his jaws and snapped down upon Timotaíne. Only his lower torso remained — his once dark green robes now dyed crimson, and his staff lying in a pool of blood.

The room was silent. Dean stared down at his twenty-sided die, eyes wide with surprise and grief for Timotaíne. The die had been rolled for the dragon’s attack; it was visible to all, and it read ‘20’. The five knew perfectly well of what just happened. “I- I’m dead? Timotaíne… is dead?” his question was answered in silence, and eventually Dean murmured “Sorry, Tim.” It all unraveled for Tim, all the fantasy games he had played, all the adventures through dungeons with his friends… Tears began to flow. None of it was real.

“I had that character for five years. None of this is real.”

“It’s gonna be O—”

“No it won’t! All these games we play, all this about Middle Earth, about Star Trek, not a bit of it is real! It’s all a lie! In reality, this stuff doesn’t just pop up when you’re in school or at work, it still leaves you dealing with drunk bum parents all the time! People are still raped and sold in black markets, people still kill each other because their gods are different, and people still commit suicide! Dungeons and Dragons doesn’t change a single one of those; it can’t stop war! In real life, we don’t just stroll into icy caves and slaughter its inhabitants for the pile of gold behind it! We are still pushed around and mocked all day! Just last week a kid did some geeky accent and yelled “Lighting Bolt!” after he threw a book at me! When we take a reality check on this whole world situation or this fantasy land we created here, we see that all of that sin still happens today, and no matter what way you spin it, it will still be there, just maybe at a different angle.”

“But is it not still an escape from the rest of the world, my friend? That’s why people play, Tim; they know this reality is sick and even more twisted that any world I can generate. We play because of that exact reason; we don’t want to face the real world.”

Tim’s tears dried; he had never quite thought of it such a way. Wounds can be licked and healed, and the harsh nature of reality can be lessened through many means… one of them being to enter a fantasy land. Empathetic friends patted his back; everyone in the room felt his anguish.

This story, written by a good friend of HiLobrow, recently took first place in the Wyoming State Reading Council’s Young Authors Competition, in the 10th Grade Fiction category. We are grateful for permission to publish it here.

MORE ORIGINAL FICTION from HILOBROW: James Parker’s swearing-animal fable The Ballad of Cocky The Fox, later published in limited-edition paperback by HiLoBooks; plus: a newsletter, The Sniffer, by Patrick Cates, and further stories: “The Cockarillion”) | Karinne Keithley Syers’s hollow-earth adventure Linda, later published in limited-edition paperback; plus: ukulele music, and a “Floating Appendix”) | Matthew Battles’s stories “Gita Nova“, “Makes the Man,” “Imago,” “Camera Lucida,” “A Simple Message”, “Children of the Volcano”, “The Gnomon”, “Billable Memories”, “For Provisional Description of Superficial Features”, “The Dogs in the Trees”, “The Sovereignties of Invention”, and “Survivor: The Island of Dr. Moreau”; several of these later appeared in the collection The Sovereignties of Invention, published by Red Lemonade | Robert Waldron’s high-school campus roman à clef The School on the Fens | Peggy Nelson’s “Mood Indigo“, “Top Kill Fail“, and “Mercerism” | Annalee Newitz’s “The Great Oxygen Race” | Joshua Glenn’s “The Lawless One”, and the mashup story “Zarathustra vs. Swamp Thing” | Adam McGovern and Paolo Leandri’s Idoru Jones comics | John Holbo’s “Sugarplum Squeampunk” | “Another Corporate Death” (1) and “Another Corporate Death” (2) by Mike Fleisch | Kathryn Kuitenbrouwer and Frank Fiorentino’s graphic novel “The Song of Otto” (excerpt) | “Manoj” and “Josh” by Vijay Balakrishnan | “Verge” by Chris Rossi, and his audio novel Low Priority Hero | EPIC WINS: THE ILIAD (1.408-415) by Flourish Klink | EPIC WINS: THE KALEVALA (3.1-278) by James Parker | EPIC WINS: THE ARGONAUTICA (2.815-834) by Joshua Glenn | EPIC WINS: THE ILIAD by Stephen Burt | EPIC WINS: THE MYTH OF THE ELK by Matthew Battles | EPIC WINS: GOTHAMIAD by Chad Parmenter | TROUBLED SUPERHUMAN CONTEST: Charles Pappas, “The Law” | CATASTROPHE CONTEST: Timothy Raymond, “Hem and the Flood” | TELEPATHY CONTEST: Rachel Ellis Adams, “Fatima, Can You Hear Me?” | OIL SPILL CONTEST: A.E. Smith, “Sound Thinking | LITTLE NEMO CAPTION CONTEST: Joe Lyons, “Necronomicon” | SPOOKY-KOOKY CONTEST: Tucker Cummings, “Well Marbled” | INVENT-A-HERO CONTEST: TG Gibbon, “The Firefly” | FANFICTION CONTEST: Lyette Mercier’s “Sex and the Single Superhero”

HiLobrow is pleased to present the fifteenth installment of our serialization of Cicely Hamilton’s Theodore Savage (also known as Lest Ye Die). New installments will appear each Monday for 25 weeks.

When war breaks out in Europe — war which aims successfully to displace entire populations — British civilization collapses utterly and overnight. The ironically named Theodore Savage, an educated and dissatisfied idler, must learn to survive by his wits in the new England, where 20th-century science, technology, and culture are regarded with superstitious awe and terror.

The book — by a writer best known today for her suffragist plays, treatises, and activism — was published in 1922. In September 2013, HiLoBooks will publish it in a gorgeous paperback edition, with an Introduction by Gary Panter.

SUBSCRIBE to HiLobrow’s serialized fiction via RSS.

ALL EXCERPTS: 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | 22 | 23 | 24 | 25

The irritation came to a head one afternoon in the early days of autumn when, with persistent ill-luck, he had been fishing a mile or so from home. Various causes combined to bring about the actual outbreak; a growing anxiety with regard to the winter supply of provisions, sharpened by the discovery, the night before, that a considerable proportion of his store of vegetables was a failure and already malodorous; the ill-success of several hours’ fishing, and gusty, unpleasant weather that chilled him as he huddled by the water. The weather worsened after mid-day, the gusts bringing rain in their wake; a cold slanting shower that sent him, in all haste, to the clump of trees where Ada had sheltered since the morning. The sight of her sitting there to keep an eye on him — uselessly watchful and shivering to no purpose — annoyed him suddenly and violently; he turned on her sharply, as the shower passed, and bade her go home on the instant. She was to keep a good fire, a blazing fire — he would be drenched and chilled by the evening. She was to have water boiling that the meal might be cooked the moment he returned with the wherewithal…. While he spoke she eyed him with questioning, distrustful sullenness; then, convinced that he meant what he said, half rose — only, after a moment of further hesitation, to slide down to her former position with her back against the trunk of a beech-tree.

“I don’t want to,” she said doggedly. “I want to stay ’ere. I don’t see why I shouldn’t. What d’yer want to get rid of me for?”

The suspicion that lay at the back of the refusal infuriated him: it was suddenly intolerable to be followed and spied on, and he lost his temper badly. The rough-tongued vehemence of his anger surprised himself as much as it frightened his wife; he swore at her, threatened to duck her in the stream, and poured out his grievances abusively. What good was she? — a clog on him, who could not even tend a fire, a helpless idiot who had to be waited on, a butter-fingered idler without brains! Let her do what he told her and make herself of use, unless she wanted to be turned out to fend for herself…. Much of what he said was justified, but it was put savagely and coarsely; and when — cowed, perhaps, by the suggestion of a ducking — Ada had taken to her heels in tears, he was remorseful as well as surprised at his own vehemence. He had not known himself as a man who could rail brutally and use threats to a woman; the revelation of his new possibilities troubled him; and when, towards sundown, he gathered up his meagre prey and stepped out homeward, it was with the full intention of making amends to Ada for the roughness of his recent outburst.

His path took him through a copse of brush-wood into what had been a cart-track; now grass-grown and crumbling between hedges that straggled and encroached. The wind, rising steadily, was sweeping ragged clouds before it and as he emerged from the shelter of the copse he was met by a stinging rain. He bent his head to it, in shivering discomfort, thrusting chilled hands under his cloak for warmth and longing for the blaze and the good warm meal that should thaw them; he had left the copse a good minute behind him when, from the further side of the overgrown hedge, he heard sudden rending of brambles, a thud, and a human cry. A yard or two on was a gap in the hedge where a gate still swung on its hinges; he rushed to it, quivering at the thought of possibilities — and found Ada struggling to her knees!

She began to cry loudly when she saw him, like a child caught in flagrant transgression; protesting, with bawling and angry tears, that “she wasn’t going to be ordered about” and “she should stay just where she liked!” It did not take him long to gather that her previous flight had been a semblance only and that, shivering and haunted by ridiculous suspicion, she had watched him all the afternoon from behind the screen of the copsewood — for company partly, but chiefly to make sure he was there. Seeing him gather up his tackle and depart homeward, she had tried to outpace him unseen; keeping the hedge between them as she ran and hoping to avert a second explosion of his wrath by blowing up the ashes of the lire before his arrival at the camp. An unsuspected rabbit-burrow had tripped her hurrying feet and brought about disaster and discovery; and she made unskilful efforts to turn the misfortune to account by rubbing her leg and complaining of damage sustained.

In contact with her stubborn folly his repentance and kindly resolutions were forgotten; he cut short her bid for sympathy with a curt “Get along with you,” caught her by the arm and started her with a push along the road — too angry to notice that, for the first time, he had handled her with actual violence. Then, bending his head to the sweep of the rain, he strode on, leaving her to follow as she would.

Perhaps her leg really pained her, perhaps she judged it best to keep her distance from his wrath; at any rate she was a hundred yards or more behind him when he reached the camp and, stirring the ashes that should have been a fire, found only a flicker alive. He cursed Ada’s idiocy between his chattering teeth as he set to work to re-kindle the fire; his hands shaking, half from anger, half from cold, as he gathered the fuel together. When, after a long interval of coaxing and cursing, the flame quivered up into the twilight, it showed him Ada sitting humped at the entrance to their shelter; and at sight of her, inert and watching him — watching him! — his wrath flared sudden and furious.

“Have you filled the cookpot?” he asked, standing over her. “No?… Then what were you doing — sitting there staring while I worked?”

She began to whimper, “You’re crool to me!” — and repeated her parrot-like burden of futile suspicion and grievance; that she knew he wanted to get her out of the way so as he could leave her, and she couldn’t be left alone for the night! He had a sense of being smothered by her foolish, invertebrate persistence, and as he caught her by the shoulders he trembled and sputtered with rage.

“God in Heaven, what’s the good of talking to you? If you take me for a liar, you take me — that’s all. Do you think I care a curse for your opinion?… But one thing’s certain — you’ll do what I tell you, and you’ll work. Work, do you hear? — not sit in a lump and idle and stare while I wait on you! Learn to use your silly hands, not expect me to light the fire and feed you. And you’ll obey, I tell you — you’ll do what you’re told. If not — I’ll teach you…”

He was wearied, thwarted, wet through and unfed since the morning; baulked of fire and a meal by the folly that had irked him for days; a man living primitively, in contact with nature and brought face to face with the workings of the law of the strongest. It chanced that she had lumped herself down by the bundle of osier-rods he had laid together for his basket-making; so that when he gripped her by the nape of the neck a weapon lay ready to his hand. He used it effectively, while she wriggled, plunged and howled; there was nothing of the Spartan in her temperament, and each swooping stroke produced a yell. He counted a dozen and then dropped her, leaving her to rub and bemoan her smarts while he filled the cookpot at the stream.

When he came back with the cookpot filled, her noisy blubbering had died into gulps and snuffles. The heat of his anger was likewise over, having worked itself off by the mere act of chastisement, and with its cooling he was conscious of a certain embarrassment. If he did not repent he was at least uneasy — not sure how to treat her and speak to her — and he covered his uneasiness, as best he might, by a busy scraping and cleaning of fish and a noisy snapping of firewood…. A wiser woman might have guessed his embarrassment from his bearing and movements and known how to wrest an advantage by transforming it into remorse; Ada, sitting huddled and smarting on her moss-bed, found no more effective protest against ill-treatment than a series of unbecoming sniffs. With every silent moment his position grew stronger, hers weaker; unconsciously he sensed her acquiescence in the new and brutal relation, and when — over his shoulder — he bade her “Come along, if you want any supper,” he knew, without looking, that she would come at his word, take the food that he gave her and eat.

They discussed the subject once and very briefly — at the latter end of a meal consumed in silence. A full stomach gives courage and confidence; and Ada, having supped and been heartened, tried a sulky “You’ve been very crool to me.”

In answer, she was told, “You deserved it.”

After this unpromising beginning it took her two or three minutes to decide on her next observation.

“I believe,” she quavered tearfully, “you’ve taken the skin off my back.”

“Nonsense!” he said curtly. Which was true.

The episode marked his acceptance of a new standard, his definite abandonment of the code of civilization in dealings between woman and man. With another wife than Ada the lapse into primitive relations would have been less swift and certainly far less complete; she was so plainly his mental inferior, so plainly amenable to the argument of force and no other, that she facilitated his conversion to the barbaric doctrine of marriage. And his conversion was the more thorough and lasting from the success of his uncivilized methods of ruling a household; where reasoning and kindliness had failed of their purpose, the sting of the rod had worked wonders…. Ada sulked through the evening and sniffed herself to sleep; but in the morning, when he woke, she had filled the cookpot and was busied at the breakfast fire.

They had adapted themselves to their environment, the environment of primitive humanity. That morning when he started for his snaring he started alone; Ada stayed, without remonstrance, to dry moss, collect firewood and perform the small duties of the camp.

It was a solid fact that from the day of her subjection to the rod and rule of her overlord, Ada found life more bearable; and watching her, at first in puzzlement, Theodore came by degrees to understand the reason for the change in her which was induced — so it seemed — by the threat and magic of an osier-wand. In the end he realized that the fundamental cause of her sodden, stupid wretchedness had been lack of effective interest — and that in finding an interest, however humble, she had found herself a place in the world. Her interest, in the beginning, was nothing more exalted than the will to avoid a second switching; but, undignified as it was in its origin, it implied a stimulus to action which had hitherto been wanting, and a process of adaptation to the new relationship between herself and her man. By accepting him as master, with the right unquestioned of reward and punishment, she had provided herself with that object in life to which she had been unable to attain by the light of her own mentality.

With an eye on the osier-heap she worked that she might please and, finding occupation, brooded less; learning imperceptibly to look-on the new world primitive as a reality whose hardships could be mitigated by effort,” instead of an impossible nightmare. As she wrestled with present difficulties — the daily tasks she dared no longer neglect — the trams, shop-windows and chiffons of the past receded on her mental horizon. Not, fundamentally, that they were any less dear to her; but the need of placating an overlord at hand took up part of her thoughts and time. Too slothful, both in mind and in body, to acquire of her own intelligence and initiative the changed habits demanded by her changed surroundings, she was unconsciously relieved — because instantly more comfortable — when the necessary habits were forced on her.

With the allotment of her duties and the tacit definition of her status that followed on the night of her chastisement, their life on the whole became easier, better regulated; and the mere fact of their frequent separation during part of the day made their coming together more pleasant. Companionship in any but the material sense it was out of her power to offer; but she could give her man a welcome at the end of the day and take lighter work off his hands. Her cooking was always a matter of guesswork and to the last she was stupid, unresourceful and clumsy with her fingers; but she fetched and carried, washed pots and garments in the stream, was hewer of wood and drawer of water and kept their camp clean and in order. In time she even learned to take a certain amount of pleasure in the due fulfilment of her task-work; when Theodore, having discovered a Spanish chestnut-tree not far from their dwelling, set her the job of storing nuts against the winter, she pointed with pride in the evening to the size of the heap she had collected.

Now that she was admittedly his underling, subdued to his authority, he found it infinitely easier to be patient with her many blunders; and though there were still moments when her brainlessness and limitations galled him to anger, on the whole he grew fonder of her — with a patronizing, kindly affection. He still cherished his plans of exploration unhampered by her company but, from pity for the fears she no longer dared to talk of, refrained from present mention thereof; while the nights were long and dark it would be cruel to leave her, and by the time spring came round again she might have grown less fearful of solitude…. Or, before spring came, the world might make a sign and plans of exploration be needless.

Meanwhile, resigning himself to his daily and solitary round, he worked hard and anxiously to provision his household for a second winter of loneliness.

Stay tuned!

RADIUM AGE SCIENCE FICTION: “Radium Age” is HiLobrow’s name for the 1904–33 era, which saw the discovery of radioactivity, the revelation that matter itself is constantly in movement — a fitting metaphor for the first decades of the 20th century, during which old scientific, religious, political, and social certainties were shattered. This era also saw the publication of genre-shattering writing by Edgar Rice Burroughs, Sax Rohmer, E.E. “Doc” Smith, Jack London, Arthur Conan Doyle, Aldous Huxley, Olaf Stapledon, Karel Čapek, H.P. Lovecraft, Charlotte Perkins Gilman, Yevgeny Zamyatin, Philip Gordon Wylie, and other pioneers of post-Verne/Wells, pre-Golden Age “science fiction.” More info here.

HILOBOOKS: The mission of HiLoBooks is to serialize novels on HiLobrow; and also, as of 2012, operating as an imprint of Richard Nash’s Cursor, to reissue Radium Age science fiction in beautiful new print editions. So far, we have published Jack London’s The Scarlet Plague, Rudyard Kipling’s With the Night Mail (and “As Easy as A.B.C.”), Arthur Conan Doyle’s The Poison Belt, H. Rider Haggard’s When the World Shook, Edward Shanks’s The People of the Ruins, William Hope Hodgson’s The Night Land, and J.D. Beresford’s Goslings. Forthcoming: E.V. Odle’s The Clockwork Man, Cicely Hamilton’s Theodore Savage, and Muriel Jaeger’s The Man with Six Senses. For more information, visit the HiLoBooks homepage.

READ: Jack London’s The Scarlet Plague, serialized between January and April 2012; Rudyard Kipling’s With the Night Mail (and “As Easy as A.B.C.”), serialized between March and June 2012; Arthur Conan Doyle’s The Poison Belt, serialized between April and July 2012; H. Rider Haggard’s When the World Shook, serialized between March and August 2012; Edward Shanks’ The People of the Ruins, serialized between May and September 2012; William Hope Hodgson’s The Night Land, serialized between June and December 2012; J.D. Beresford’s Goslings, serialized between September 2012 and May 2013; and Cicely Hamilton’s Theodore Savage, serialized between March and August 2013.

WALLACE “WALLY” WOOD (1927—1981) is one of those pop creators you remember on his own, not connected to any colony or company — which sets him apart, but also above, the very prominent points on the 20th century cultural landscape you do think of him profoundly affecting. The hyperreal detail of every circuit and tube in his signature sci-fi setpieces — with which he made himself and helped make EC Comics famous as an early symbol of sophistication in the comicbook medium during the 1950s — were a high-tech Pre-Raphaelite canvas, and an anticipation of the hi-res CGI of a coming century (and frequently in the spaceship and revived-dinosaur settings that medium so often arcs to). The fluid choreography yet static composition he brought to later costumed action, redefining Marvel’s Daredevil in the visual form we still know now (striking but revolutionarily uniform all-red suit), were like statue groupings of antiquity, frozen in classic solidity yet levitatingly lighter than air, a Matrix premonition with an ancient Greek seriousness. He lasted very briefly on that co-re-creation, striking out alone to spearhead 1960s Marvel competitor Tower Comics, a legendary third-party enterprise known for its photographic-seeming rendering and its stories’ realistic consequence (all the imprint’s flagship “T.H.U.N.D.E.R. Agents” were at risk of shortening their lifespans with their body-enhancing Q-like strike-force gadgetry). He cut a cowboy blues album, and led some of the earliest indie comics, a senior statesman lending his authority to the uprising in the artform’s corporate culture and its common future. (He was also more than a bit of a pornographer, but that turned out to be the leading industry of the future too.) And then he killed himself, leaving the future to everyone else.

***

On his or her birthday, HiLobrow irregularly pays tribute to one of our high-, low-, no-, or hilobrow heroes. Also born this date: Jello Biafra.

READ MORE about members of the Postmodernist Generation (1924-33).

The prolific science fiction writer MURRAY LEINSTER (William Fitzgerald Jenkins, 1896–1975) is one of the few Radium Age sf authors — his first sf story, “The Runaway Skyscraper,” appeared in a 1919 issue of Argosy — who was able to find success after the mid-1930s. In fact, John W. Campbell, whose editorship of Astounding sparked the Golden Age, published a number of Leinster stories; and it’s worth noting that one of Leinster’s first editors was H.L. Mencken. During the 1920s and ’30s, the prolific Leinster rehearsed the themes — often, in contributions to Hugo Gernsback’s pulp magazines — for which he’d become well-known later. During science fiction’s so-called Golden Age, his 1934 story “Sidewise in Time” was the first alternate-history yarn… not to mention the first to pose the enduring question, “What if the South won the Civil War?” The title of Leinster’s 1945 aliens-meet-humans story “First Contact” gave us a phrase that today seems natural and inevitable. Most impressively, perhaps, Leinster’s 1946 story “A Logic Named Joe” offers a prescient look not only at home computers (“logics”) but at the interconnection of those computers via a distributed system of servers (“tanks”) which stream communications, entertainment, data access, and commerce into every home. Yes: the Internet!

***

On his or her birthday, HiLobrow irregularly pays tribute to one of our high-, low-, no-, or hilobrow heroes. Also born this date: Stan Laurel, Barbara McClintock, Leroy Sievers.

READ MORE about members of the Hardboiled Generation (1894-1903).

READ MORE ABOUT: HiLoBooks homepage! | What is Radium Age science fiction? | Radium Age Supermen | Radium Age Robots | Radium Age Apocalypses | Radium Age Telepaths | Radium Age Eco-Catastrophes | Radium Age Cover Art (1) | SF’s Best Year Ever: 1912 | Radium Age Science Fiction Poetry | Enter Highbrowism | Bathybius! Primordial ooze in Radium Age sf | War and Peace Games (H.G. Wells’s training manuals for supermen) | J.D. Beresford | Algernon Blackwood | Edgar Rice Burroughs | Karel Čapek | Buster Crabbe | August Derleth | Arthur Conan Doyle | Charlotte Perkins Gilman | Cicely Hamilton | Hermann Hesse | Aldous Huxley | Inez Haynes Irwin | Alfred Jarry | Jack Kirby (Radium Age sf’s influence on) | Murray Leinster | Gaston Leroux | David Lindsay | Jack London | H.P. Lovecraft | A. Merritt | Maureen O’Sullivan | Sax Rohmer | Paul Scheerbart | Upton Sinclair | Clark Ashton Smith | E.E. “Doc” Smith | Olaf Stapledon | John Taine | H.G. Wells | Jack Williamson | Stanisław Ignacy Witkiewicz | S. Fowler Wright | Philip Gordon Wylie | Yevgeny Zamyatin

Best known today as a propagandist for the suffrage movement during the 1900s–10s, the Anglo-Irish author CICELY HAMILTON (Cicely Hammill, 1872–1952) co-founded the Women Writers’ Suffrage League, supplied the lyrics for the 1910 anthem “The March of the Women,” and wrote and produced feminist plays including Diana of Dobson’s (1908), How the Vote Was Won (1909), and A Pageant of Great Women (1910). During World War I, she joined the British army and organized an ambulance unit, then worked as a nurse at a military hospital in France; in the 1930s she published a popular series of travelogues, as well as a 1935 autobiography mischievously titled Life Errant. My particular interest in Hamilton is due to none of these things — though I do find her witty, cynical 1909 treatise Marriage as a Trade, which anticipates Betty Friedan and Valerie Solanas by six decades, an enjoyable read. Instead, I’m a fan of Hamilton’s Theodore Savage: A Story of the Past or the Future (1922), one of the first science fiction novels by a woman. The reviewer who suggested that it might be used “as a tract to convey an awful warning” was no doubt referring to the book’s apocalyptic scenes, in which the displacement of entire populations becomes a brutal military strategy; but in the latter half of the story we also find a warning about the degraded state of modern women, who — “unhandy, unresourceful, superficial” — would in a post-apocalyptic social order no doubt suffer a particularly sad fate.

***

In October 2013, HiLoBooks will publish a gorgeous paperback edition of Cicely Hamilton’s Theodore Savage, with an Introduction by Gary Panter. From March through August of 2013, HiLobrow is serializing the book in 25 illustrated installments.

On his or her birthday, HiLobrow irregularly pays tribute to one of our high-, low-, no-, or hilobrow heroes. Also born this date: Hugo Pratt, Neil Patrick Harris, John Wesley Work III, and Herbert Simon.

READ MORE about members of the Anarcho-Symbolist Generation (1864–73).

READ MORE ABOUT SCIENCE FICTION’S RADIUM AGE (1904–33): HiLoBooks homepage! | What is Radium Age science fiction? | Radium Age Supermen | Radium Age Robots | Radium Age Apocalypses | Radium Age Telepaths | Radium Age Eco-Catastrophes | Radium Age Cover Art (1) | SF’s Best Year Ever: 1912 | Radium Age Science Fiction Poetry | Enter Highbrowism | Bathybius! Primordial ooze in Radium Age sf | War and Peace Games (H.G. Wells’s training manuals for supermen) | J.D. Beresford | Algernon Blackwood | Edgar Rice Burroughs | Karel Čapek | Buster Crabbe | August Derleth | Arthur Conan Doyle | Charlotte Perkins Gilman | Cicely Hamilton | Hermann Hesse | Aldous Huxley | Inez Haynes Irwin | Alfred Jarry | Jack Kirby (Radium Age sf’s influence on) | Murray Leinster | Gaston Leroux | David Lindsay | Jack London | H.P. Lovecraft | A. Merritt | Maureen O’Sullivan | Sax Rohmer | Paul Scheerbart | Upton Sinclair | Clark Ashton Smith | E.E. “Doc” Smith | Olaf Stapledon | John Taine | H.G. Wells | Jack Williamson | Stanisław Ignacy Witkiewicz | S. Fowler Wright | Philip Gordon Wylie | Yevgeny Zamyatin

HiLobrow is proud to present the nineteenth installment of Robert Waldron’s novel The School on the Fens. New installments will appear each Saturday for thirty-eight weeks. CLICK HERE to read all installments published thus far.

The next day the headmaster summoned me to his office. To my surprise, Mary greeted me with a smile and ushered me right in. Farrell was tired or hungover or both. He was his usual bureaucratic self, impeccably turned out in a double-breasted tan suit and maroon silk tie, but his mousy hair looked greasy, and I wondered if he had skipped a morning shower.

“Good to see you last night but wish more teachers had attended,” he said from behind his desk while motioning me to take a seat.

“It’s difficult to party during the week,” I said, “when you have to teach a full program the next day.”

“Didn’t stop you, did it?”

“No, but I had an ulterior motive.”

“Ulterior motive?”

“I’d heard your Pilot School was being raised from the dead… and I needed verification.”

Farrell laughed. “But it was never dead, only in a coma. You’re still opposed to it?’

“Yes.”

“Will anything change your mind?”

“Don’t think so.”

Mary carried in a tray of coffee and croissants. As she poured coffee for the two of us, she glanced over at me, her eyes two blue stones in nests of wrinkles. To my surprise, she again smiled. Seems my stock had gone up. When she left, Farrell resumed, “I need your help, John. Murphy’s million dollars is contingent upon implementing the Nexus Program. If it doesn’t fly, we lose the money. You’ve a lot of influence with the faculty.”

“It’s not good for the school, especially if Latin is removed from the curriculum.”

“Students will take Latin when they enter the ninth grade.”

“Bad idea. Seventh and eighth graders should study Latin. Why do you think our SAT scores haven’t plummeted like the rest of the country?”

“Our kids are bright, it’s why they score high. Latin’s got nothing to do with it.”

“You’re gambling with our students’ future.”

He pinched a croissant with his thumb and index finger, dipped it into his coffee and took a bite.

“Think of it, one million dollars,” he said. “We can do a lot with that money.”

Yes, I thought, like reward your sycophants with smaller classes and our students will be treated to more field trips, fun and more fun. The parents will be happy, and you will be hailed as an educational leader, and your reward a phony doctorate.

“Let me make this easy for you,” I said. “If I convince the faculty to accept Nexus, I’ve got the chairmanship. Right?”

“In a nutshell.”

He gulped coffee, looked at me and smiled a knowing smile as if he was certain I’d take the bait.

“I have to refuse,” I said. “Classical is too important to sacrifice its standards for educational fluff.”

“Are you refusing a substantial pay hike and a preferential school program?”

“With two kids still in college, I could use the money, but I have to decline your offer.”

He paused to sip coffee.

“What if we keep Latin in the lower grades?”

“Better. But everyone passes, right?”

“You object?”

“Students shouldn’t pass just for coming to school. They should learn to face the consequences of their actions, and if they fail to do their work, they shouldn’t be rewarded with passing grades.”

“We need this program to lower the attrition rate among minorities.”

Ah, so that was his rationale.

“There are better strategies.”

“Minority parents are angry that their kids are flunking out.”

“The minority attrition rate has actually decreased.”

“Not enough. We’ve got to do more.”

Had I misjudged him? Was his purpose altruistic?

“I’ve given a lot of thought to this issue,” he continued. “Minorities just can’t do the work. Christ, look at the Asians; they’ve only been in this country a few years, and they’re at the top of their classes.” He paused. “To appease the minority community we need Nexus.”

No, I hadn’t misjudged him; he was still a bigot.

“Do you intend to campaign against the plan?”

“Besides educational issues, there are union issues at stake.”

“What would it cost to keep your mouth shut,” he asked, his left eyebrow twitching.

I stood up. “I’ll speak against the program to all union members.”

The bell rang for the next period. Farrell abruptly stood, tipping over his coffee.

“You’d be happier at another school.”

“Another school?”

“Yes, you’re behind the times.”

“I’m not leaving Classical. In fact, it may be you who’ll be leaving… I know all about you and Tim O’Donnell.”

For once in his life Farrell was speechless.

“I haven’t decided what to do with this information,” I continued, “but I won’t be transferring anywhere.”

“Don’t know what you’re talking about.”

“You don’t remember Thompson’s walking in on you and Tim?”

“Get the hell out of here!”

On my way back to my room, I felt a surge of confidence. For once in my career, I actually had the upper hand. Of course, I was totally ignorant about how to use it.

A few days later, Jocelyn Yates stopped by my homeroom after school. Jocelyn had the distinction of being Classical’s first African-American teacher, a gifted woman with high academic standards. “No fads for me,” she once said. “The kids, me, and the book — it’s all I need.” When I said I couldn’t agree more, we bonded as allies in the English department.

She looked troubled as she slid into one of the portable desks. She had recently been called to the headmaster’s office. Like all of us when summoned, she thought that she had either missed a school chore or that a tragedy had occurred at home. She was astonished to hear Farrell’s offering her the department chairmanship.

“John, I don’t want the position. I’ve got two children at home. When I recommended you for the job, he said I shouldn’t discuss it with you.”

“I appreciate your vote of confidence. On what day did he offer you the job?”

It was two days before he had offered it to me. So he’d had no intention of appointing me. He was just trying to use me to launch his Pilot School.

“How did you leave it with him?” I said.

“I said I’d think about it.”

“Jocelyn, I think you’d make a great head of department.”

“You’re the senior member of the department, and by right it should go to you.”

“It won’t happen, not as long as Farrell’s headmaster.”

“I wish he’d get a promotion and drive the people downtown crazy.”

We laughed.

“Why would Farrell say not to discuss it with you?”

“He offered the job to me too. He said if I went along with his Pilot School, I can have it.”

“Bribery and lies?”

I nodded.

“He’s a piece of work.” She stood and left shaking her head.

It would be sweet revenge for Farrell if I had helped convince the faculty to accept Nexus only to watch him hand over the chairmanship not to me but to Jocelyn. It would serve as his exemplum: “See, Duncan, this is the way the real world works.”

Stay tuned!

ORIGINAL FICTION from HILOBROW: James Parker’s swearing-animal fable The Ballad of Cocky The Fox, later published in limited-edition paperback by HiLoBooks; plus: a newsletter, The Sniffer, by Patrick Cates, and further stories: “The Cockarillion”) | Karinne Keithley Syers’s hollow-earth adventure Linda, later published in limited-edition paperback; plus: ukulele music, and a “Floating Appendix”) | Matthew Battles’s stories “Gita Nova“, “Makes the Man,” “Imago,” “Camera Lucida,” “A Simple Message”, “Children of the Volcano”, “The Gnomon”, “Billable Memories”, “For Provisional Description of Superficial Features”, “The Dogs in the Trees”, “The Sovereignties of Invention”, and “Survivor: The Island of Dr. Moreau”; several of these later appeared in the collection The Sovereignties of Invention, published by Red Lemonade | Robert Waldron’s high-school campus roman à clef The School on the Fens | Peggy Nelson’s “Mood Indigo“, “Top Kill Fail“, and “Mercerism” | Annalee Newitz’s “The Great Oxygen Race” | Joshua Glenn’s “The Lawless One”, and the mashup story “Zarathustra vs. Swamp Thing” | Adam McGovern and Paolo Leandri’s Idoru Jones comics | John Holbo’s “Sugarplum Squeampunk” | “Another Corporate Death” (1) and “Another Corporate Death” (2) by Mike Fleisch | Kathryn Kuitenbrouwer and Frank Fiorentino’s graphic novel “The Song of Otto” (excerpt) | “Manoj” and “Josh” by Vijay Balakrishnan | “Verge” by Chris Rossi, and his audio novel Low Priority Hero | EPIC WINS: THE ILIAD (1.408-415) by Flourish Klink | EPIC WINS: THE KALEVALA (3.1-278) by James Parker | EPIC WINS: THE ARGONAUTICA (2.815-834) by Joshua Glenn | EPIC WINS: THE ILIAD by Stephen Burt | EPIC WINS: THE MYTH OF THE ELK by Matthew Battles | EPIC WINS: GOTHAMIAD by Chad Parmenter | TROUBLED SUPERHUMAN CONTEST: Charles Pappas, “The Law” | CATASTROPHE CONTEST: Timothy Raymond, “Hem and the Flood” | TELEPATHY CONTEST: Rachel Ellis Adams, “Fatima, Can You Hear Me?” | OIL SPILL CONTEST: A.E. Smith, “Sound Thinking | LITTLE NEMO CAPTION CONTEST: Joe Lyons, “Necronomicon” | SPOOKY-KOOKY CONTEST: Tucker Cummings, “Well Marbled” | INVENT-A-HERO CONTEST: TG Gibbon, “The Firefly” | FANFICTION CONTEST: Lyette Mercier’s “Sex and the Single Superhero”

I never watched Doogie Howser, M.D., the 1989-1993 series about a teenage doctor, and so had no reason to imagine that its star, NEIL PATRICK HARRIS (born 1973), was much more than the means to a gimmicky end in the years when producer Steven Bochco was hatching ambitious, misguided flops like Cop Rock. My main Harris memory is of a post-Doogie guest shot on the David Letterman show, when he bemoaned the unforeseen hassles of equipping his first real house (“You have to buy forks… you have to buy sheets… you have to buy extra sheets…”). But it turns out that for litheness, likability, and genius timing, Harris is the Jack Lemmon of now. As Barney, the hedonistic high-fiver of the beguiling sitcom How I Met Your Mother, Harris plays a bantam cock who fancies himself a rooster, and who by sheer manic devotion to the maintenance of his own “awesomeness” earns the status. Almost every line Barney speaks emerges through multiple layers of TV-baby self-monitoring, origami folds of irony, and douchebaggery so elaborately staged it becomes a form of vocal and physical tap dance.

Why should, how can, this preening sexist, this smug turd, be so goddamned charming? I don’t know; how does a card trickster turn a three of clubs into a king of diamonds? Harris, it says here, is among other things a working magician. We might have guessed that — not merely from his occasional, always endearingly fumbled attempts at magic on Mother, but also because Harris’s particular dazzling skill is very much a matter of smooth handwork and misdirection, the invisibility of seams and the impossibility of sweat, the momentary conjuring of the objectively impossible.

***

On his or her birthday, HiLobrow irregularly pays tribute to one of our high-, low-, no-, or hilobrow heroes. Also born this date: Hugo Pratt, John Wesley Work III, Herbert Simon, Cicely Hamilton.

READ MORE about men and women born on the cusp between the Reconstructionist (1964–73) and Revivalist (1974-82) Generations.

Fear not, it is here.

It is Ear Candy today, as we feature sound and media artist Joerg Piringer. First up, chromosome one, in which the first chromosome in the human genome is sung by the computer.

And in case you may be inspired to sing along, here are the lyrics:

the human genome. chromosome one (excerpt):


GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA
TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA
TCTAGAAGGTAGAGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCAT
GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAG
CTAGAAGAAAAGCATTGGGAAGTTTCCAACATGAAGAAAAGATAAATGGTCAAGGGAATG
GATATCCTAATTACCCTGATTTGATCATTATGCATTATATACATGAATCAAAATATCACA
CATACCTTCAAACTATGTACAAATATTATATACCAATAAAAAATCATCATCATCATCTCC
ATCATCACCACCCTCCTCCTCATCACCACCAGCATCACCACCATCATCACCACCACCATC
ATCACCACCACCACTGCCATCATCATCACCACCACTGTGCCATCATCATCACCACCACTG
TCATTATCACCACCACCATCATCACCAACACCACTGCCATCGTCATCACCACCACTGTCA
TTATCACCACCACCATCACCAACATCACCACCACCATTATCACCACCATCAACACCACCA
CCCCCATCATCATCATCACTACTACCATCATTACCAGCACCACCACCACTATCACCACCA
CCACCACAATCACCATCACCACTATCATCAACATCATCACTACCACCATCACCAACACCA
CCATCATTATCACCACCACCACCATCACCAACATCACCACCATCATCATCACCACCATCA
CCAAGACCATCATCATCACCATCACCACCAACATCACCACCATCACCAACACCACCATCA
CCACCACCACCACCATCATCACCACCACCACCATCATCATCACCACCACCGCCATCATCA
TCGCCACCACCATGACCACCACCATCACAACCATCACCACCATCACAACCACCATCATCA
CTATCGCTATCACCACCATCACCATTACCACCACCATTACTACAACCATGACCATCACCA
CCATCACCACCACCATCACAACGATCACCATCACAGCCACCATCATCACCACCACCACCA
CCACCATCACCATCAAACCATCGGCATTATTATTTTTTTAGAATTTTGTTGGGATTCAGT
ATCTGCCAAGATACCCATTCTTAAAACATGAAAAAGCAGCTGACCCTCCTGTGGCCCCCT
TTTTGGGCAGTCATTGCAGGACCTCATCCCCAAGCAGCAGCTCTGGTGGCATACAGGCAA
CCCACCACCAAGGTAGAGGGTAATTGAGCAGAAAAGCCACTTCCTCCAGCAGTTCCCTGT
CTGAGCTGCTGTCCTTGGACTTGAAGAAGCTTCTGGAACATGCTGGGGAGGAAGGAAGAC
ATTTCACTTATTGAGTGGCCTGATGCAGAACAGAGACCCAGCTGGTTCACTCTAGTTCGG
ACTAAAACTCACCCCTGTCTATAAGCATCAGCCTCGGCAGGATGCATTTCACATTTGTGA
TCTCATTTAACCTCCACAAAGACCCAGAAGGGTTGGTAACATTATCATACCTAGGCCTAC
TATTTTAAAAATCTAACACCCATGCAGCCCGGGCACTGAAGTGGAGGCTGGCCACGGAGA
GAGCCAGGCAATCACTGGCTTTTCCTTAGACAGAGAGCTGGTTCCTAGGAGAAGAAGCTC
CAGGCTGGGGTCCAGGCTATGACCCAACTGTTCAGTTTTGCAACATCCAGCATGGCTGCC
TGATCAGGGGTGCATATGTCAGAGGAGCCTTCAGCTGGGAAGTGCTGACAAATGACCCAG
ACCTGACCTGCCCGATGCCAAGGCCTCCTTTAGTACATCCCATGGAGGACACTTGAGACA
AAGTCACAGCTCAGCCCGTTGATTTCCCATGCTCTGACTGTGCGGTGCAGCAGGACCCCT
AGCAGGCAGCATGTGTTCAAGGCAGCGATATCCAAATGCTATGAATTGCTGTCCTGATGG
TTATTTTCCTGCATACAGTAGAGCTGATCCCTGTACAATGCTGGTCCTAAATCTCACCTT
TGACAGTGCGCTGATGTGCAATGTTTGCTTTTGTTTTATTTGATGGAACATGGCTAATTG
CTAAGAAGGTGACATGCTGCCCACTGACCACCCAATGTTCATTCTCCTCTTCTTCCTTAC
TAACAAAACTGCGGTGGTGGTGGTGAGGAGAGGGAGGGGGTATAACAAATGTGCCAAGCC
AAGAGTTTATATTTGCAAGCCTCTCTTATACCTAGAGTTGATCGTGACACAGCTCTGGCC
AATGATGTGTAAGCAGAAGTTGCTTGATGTGACTTCTGGCAAAGCTCTTAAGGAGAGGAC
TGACCTGTTTCCACATATCTTTTTCCTTTCCGTGTCCTTAGTCCTGGCTGGGATGCAGAT
GAGATGCAAAAGGTGGAGCAGCCATGTTGTCATCAGGCAGTAACAGGTCTGAGGGTAGAA
GCTGCATTCTGATAATACCAGGGAAAAATAATACAAGTAGTCTAGGGCCCAGAGATATCA
CAGATGTCCATTTGAACCCCAAATTACCTGTCTCCAGATTTGCTATCAGGCAAGAAAAGG
AAATCTTTCATTAGTTTAAGCTGTAGTTTACTCCAGTTTTCTATAACTTTCGGCCAGATA
TAACCCTAAATTGACAAAGGGGGCAAGTGCTTAACTGCAAAGCAGTTAAAACTCAAACAC
AGGCCTTCATTTCTTCAGGGTTTTAGTTTTTTCTAGGGAAGAATCTTAACTACTGCTACT
AAAAGTTATAGTAGGCCAGGGATGGTGACTCACGCCTGTAATCTCAGCACTTTGGAAGCC
CAGGCAGGTGGATCACCTGAGGTCAGGAGTTCAAGACCAGCCTGGCCAACGTGGTGAAAC
CCCATCTCTACTAAAAATACAAAAATTAGCCAGGCATGATGGTGCATGCCTGTAGTCACA
CCTACTCAGGAGGCTGAGTCAGGAGAATAGCTTGACCCAGGAGGCAGAGGTGGCAGTGAG
CCAAGATCGCACCACTGCACTCCAGCCTGGGCGACAGAGCAAGACTCTGTCTCAAAAAAA
AAAAAGTCATAATCAAAGAGGAAGACTGAGATAAATGTAGAGTCAAAGGGCTAAACAGAA
ACATAACACATGGGTTTTAAGCTAAGCCTTCACATTATCCCTTATACAATTTTATCTACA
CCGATTTCACCAAAGCTCAAAGTTATATTATTGGCTGAGATTGGCATTGGGATGGAGTGG
TGAAGCTAAGAAATTCGTTATCCCTTTGTTCCAGTGCTGCTGGACTTTTCACTAAGTGAA
GAGGTAAATGCTGAGTCTCCCAGGAGGCTGACTCCTCCTGGCTCTGGGTGTGCATTCTGA
TGAAGGTTCTTTATTGTAGGCACCAACAGAAGGCTCATGAGAGGGCAACATGGATCTCCA
TTTCTGAGCAGATGTTTAAACGCTGAATCAGGTCCAAGGCTTCCCAAATGAACTCAAGGA
GTTTCTTTTTCCCAAGCCATAGAAAGTGGCGATAGCAATCCAGGGTCTGCACTGGGAAGG
AGCACTGCCAGGACACGTCCCTCCCTGCCATTCCCCCACCCTCGCCCAGGAGACGTCCCT
CCCTGCCACCACACAGGACACATCCCTCCTTGCCATCCCACCCCCCTTCCCAGGACACGT
CCCTCCCTGCCATCCCATCCCATTCCCCCACAAGGACACGTCCCTCCCTGTCATCCCACC
CCCCTTCTCAGGACACATCCTTCCCTGCCATCCCACACCCCCCCCAGGACACGTCCCTCC
CTGCCATCCCACGCCTCCCCCCAGGACACATCCCTCCCTGCCATCCCACCCCGCCCCCCA
GGACACACAGGTCCGTGAAATCAGTATAGACACTTGTATCAAGCAAGAAGAAGCATGTTA
CTCAGAAGAACACAATTTTGTTGTTTTGTTTTTGTTTCTGGGTTTTGGTTGTTTTTTTTG
TTTTTTTTTTTGGGGAATTAAACAAATAATTTCAAGTTCTACCTCCACCACCTACCAGCT
GCATGATCTTAGACCATTGACATCACCTCCCTGACCGTGATTTTCACATCTAGAGAATGG
GAGGGGAAGAACCATGCCTTGGGGGCCAGGCTGAGGATGAACTATGAAAACCCGTCCTAT
TGGGCACTCTCGAACAGTCACCATTGTTGGTATGAGGCCCACTATCAGTGAAACTGATTG
AAATTGGTGTACATCTGAGACCTGAGGACAGCCATCAAGTGTCTATTAACTTAAGCTTTA
TGTAGCAAGCATTTATTGCACATGATCCTAGGTCCCAAGTATGCTTCGGTAAATTAAACA
CCCTTGGTCCCTGCCCTCACAAGCCGTTCATAATCTAGACAGATACATAAGATATAAATG
CACAATTGTTCATTGAAAATCTCCGAAGTCACTGGCTATTTTCTGTGGTTCTCGGCACCA
TCACCACCCTTCCAAATTCTCTCCTGTTCTCAGGGGTTAGAAACCTGCAAACTACATTCC
CTAGACTTCCTTGCCTGTAGGAGCAAAATGATCCCATGTATTACTGCGAAATGGTAGTGT
CTGGGTCCCAGAAGACAGTTAGTAGAATCAGAATGTAGGAAAGTGTGTGCCACAGCCACA
CATGTTCATGATAGTCATAACTTGTTCAGTAGGAATTTAGAGAAGACTGACTGTACACAA
GGTATTGCTAAATGCTATGCGGGATACAGAGATGCCTGTGCCTCTAAGAAACTTGGTAGA
AAAATAATAACCCACACATATTTGGCTTACCTTCTCTTTGAATAGAGCAATTGGCAGTTT
AGATTCAGTCATTCTTCAATTCATTTAGCCAAAATTTATTCTGTGATGGCTGAATCCAAC
AAATGAAGTCTCTACTCTCATATTATTTTCCATTTTGTTCCACTGAATTTCAGCAAACAT
AGACCAGACAAGCATCCCTTTGAAACCTGGACTTGGGATGAGGGTCTGCTGAGATTGGGT
TTTCTCCATGCCCAGATGCCTCTGATCAAATATCAAGTCCCAAAGATACAGATGAGAAAG
TTATTAAGTGTTCTGGGATTGGGACATCGGAGATATTAATTAACCCTGGCTTGAGATGGG
AAGAGGGGGCAGGTAGCTTTCTTTGTGTAGTGTTTAGGAAGGTGATTGCCAATCTAGGAG
AAGTGAGTTCCCCAGAGGGAGGGGGGCTCTTGGCCAGCAGGGTGACCCATATGTTCTGGT
CTGCCTGGAGCTGTGGTCCTTGGGTTCACAGCGGCCCCTTTGCACTCAAAGCACCCTAGC
TTGGACAATAAATTCTACAGTCAGTTCTGCAGTGACGATCTTCAATTCCTAGGGCTGCCA
TAAGAGAAGATCATAGACTAGGGGTGGTACACGACAGAAATTCATCTTCTCCCAGTTCTG
GAGCCTGAAAATCCAAAACAAGGTGCTGTCAGGGTTGGATTCTCCTTGGGCCTCTCTTCT
TGGCTTGCAGGTGGCTGTCTTCTGGCTGTGTCCTCGTGTGTCCCCAACATCCCCCTGTGT
GTGTGTGCAACCCTTATGTCTCTTCCTCTGCTCATAAGAAAACAGTCCTATAGGACTAGG
ACCACATTCTTATGGCCTCATTTAACCTTAATTACCTCCTTTAGGGCCCTGTCTCCAAAT
ATGTTCAGTGGAGGTTTGGGGCTTTGGCATATGAGTCTTTGGAGGCCACAGTTCTGTCCA
GAACACACTGACCCTATCCACCAGGTACTGCCACACCAATGGCTTTCAGCATTAGACAGA
GCCCCCCTGGGCTCTGTAACCCCACCCAGGGTGTTAAGAATGAGGAGTGAAAGTCCACAC
ATGTACACACATGTTAATAGCAGCATTATGCGCAACAGTCAAACAGTGGACACACCCAAA
TGCCCATCAGTGGATGATGGATACATGCAAGGTGATTTATCCAGACAGTGGCATCATATT

But what if we need something a little more specific? Something that will allow us to listen more deeply into the code that is you?

Glad you asked; here is Piringer’s passwords, in which he has collected 25,727 passwords, displayed one per frame. The longer a password, or part of one, is visible, the more people have used it:

“the sound is my computer reading the beginning of the list sped up to 13% of the original length.” – from the /joerg.piringer.net

Intrigued? Hear more:
Joerg Piringer on SoundCloud
Joerg Piringer’s website
Twitter: @jpiringer

Here’s a mind-bender: A 1915 photo of a quartet dressed up in vintage costumes, pretending to be an “old fashioned singing school.” At least one of these historical re-enactors, however, is a time traveler from the future. A time traveler from the future who is pretending to be a 1915 man re-enacting a 19th-century scene. He is also a rude time traveler who should hang up now!

Ringtone: “It’s A Long Way to Tipperary”

READ MORE by Joshua Glenn, originally published in: THE BAFFLER | BOSTON GLOBE IDEAS | BRAINIAC | CABINET | FEED | HERMENAUT | HILOBROW | HILOBROW: GENERATIONS | HILOBROW: RADIUM AGE SCIENCE FICTION | HILOBROW: SHOCKING BLOCKING | THE IDLER | IO9 | N+1 | NEW YORK TIMES BOOK REVIEW | SEMIONAUT | SLATE

Joshua Glenn’s most recent books (2012) are UNBORED: THE ESSENTIAL FIELD GUIDE TO SERIOUS FUN (with Elizabeth Foy Larsen); and SIGNIFICANT OBJECTS: 100 EXTRAORDINARY STORIES ABOUT ORDINARY THINGS (with Rob Walker).