Eye Candy (18)

By: Peggy Nelson
June 14, 2013

I know, I know, it’s Friday, and you’re asking, where is my Eye Candy? Where is it!??

Fear not, it is here.

It is Ear Candy today, as we feature sound and media artist Joerg Piringer. First up, chromosome one, in which the first chromosome in the human genome is sung by the computer.

And in case you may be inspired to sing along, here are the lyrics:

the human genome. chromosome one (excerpt):


GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA
TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA
TCTAGAAGGTAGAGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCAT
GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAG
CTAGAAGAAAAGCATTGGGAAGTTTCCAACATGAAGAAAAGATAAATGGTCAAGGGAATG
GATATCCTAATTACCCTGATTTGATCATTATGCATTATATACATGAATCAAAATATCACA
CATACCTTCAAACTATGTACAAATATTATATACCAATAAAAAATCATCATCATCATCTCC
ATCATCACCACCCTCCTCCTCATCACCACCAGCATCACCACCATCATCACCACCACCATC
ATCACCACCACCACTGCCATCATCATCACCACCACTGTGCCATCATCATCACCACCACTG
TCATTATCACCACCACCATCATCACCAACACCACTGCCATCGTCATCACCACCACTGTCA
TTATCACCACCACCATCACCAACATCACCACCACCATTATCACCACCATCAACACCACCA
CCCCCATCATCATCATCACTACTACCATCATTACCAGCACCACCACCACTATCACCACCA
CCACCACAATCACCATCACCACTATCATCAACATCATCACTACCACCATCACCAACACCA
CCATCATTATCACCACCACCACCATCACCAACATCACCACCATCATCATCACCACCATCA
CCAAGACCATCATCATCACCATCACCACCAACATCACCACCATCACCAACACCACCATCA
CCACCACCACCACCATCATCACCACCACCACCATCATCATCACCACCACCGCCATCATCA
TCGCCACCACCATGACCACCACCATCACAACCATCACCACCATCACAACCACCATCATCA
CTATCGCTATCACCACCATCACCATTACCACCACCATTACTACAACCATGACCATCACCA
CCATCACCACCACCATCACAACGATCACCATCACAGCCACCATCATCACCACCACCACCA
CCACCATCACCATCAAACCATCGGCATTATTATTTTTTTAGAATTTTGTTGGGATTCAGT
ATCTGCCAAGATACCCATTCTTAAAACATGAAAAAGCAGCTGACCCTCCTGTGGCCCCCT
TTTTGGGCAGTCATTGCAGGACCTCATCCCCAAGCAGCAGCTCTGGTGGCATACAGGCAA
CCCACCACCAAGGTAGAGGGTAATTGAGCAGAAAAGCCACTTCCTCCAGCAGTTCCCTGT
CTGAGCTGCTGTCCTTGGACTTGAAGAAGCTTCTGGAACATGCTGGGGAGGAAGGAAGAC
ATTTCACTTATTGAGTGGCCTGATGCAGAACAGAGACCCAGCTGGTTCACTCTAGTTCGG
ACTAAAACTCACCCCTGTCTATAAGCATCAGCCTCGGCAGGATGCATTTCACATTTGTGA
TCTCATTTAACCTCCACAAAGACCCAGAAGGGTTGGTAACATTATCATACCTAGGCCTAC
TATTTTAAAAATCTAACACCCATGCAGCCCGGGCACTGAAGTGGAGGCTGGCCACGGAGA
GAGCCAGGCAATCACTGGCTTTTCCTTAGACAGAGAGCTGGTTCCTAGGAGAAGAAGCTC
CAGGCTGGGGTCCAGGCTATGACCCAACTGTTCAGTTTTGCAACATCCAGCATGGCTGCC
TGATCAGGGGTGCATATGTCAGAGGAGCCTTCAGCTGGGAAGTGCTGACAAATGACCCAG
ACCTGACCTGCCCGATGCCAAGGCCTCCTTTAGTACATCCCATGGAGGACACTTGAGACA
AAGTCACAGCTCAGCCCGTTGATTTCCCATGCTCTGACTGTGCGGTGCAGCAGGACCCCT
AGCAGGCAGCATGTGTTCAAGGCAGCGATATCCAAATGCTATGAATTGCTGTCCTGATGG
TTATTTTCCTGCATACAGTAGAGCTGATCCCTGTACAATGCTGGTCCTAAATCTCACCTT
TGACAGTGCGCTGATGTGCAATGTTTGCTTTTGTTTTATTTGATGGAACATGGCTAATTG
CTAAGAAGGTGACATGCTGCCCACTGACCACCCAATGTTCATTCTCCTCTTCTTCCTTAC
TAACAAAACTGCGGTGGTGGTGGTGAGGAGAGGGAGGGGGTATAACAAATGTGCCAAGCC
AAGAGTTTATATTTGCAAGCCTCTCTTATACCTAGAGTTGATCGTGACACAGCTCTGGCC
AATGATGTGTAAGCAGAAGTTGCTTGATGTGACTTCTGGCAAAGCTCTTAAGGAGAGGAC
TGACCTGTTTCCACATATCTTTTTCCTTTCCGTGTCCTTAGTCCTGGCTGGGATGCAGAT
GAGATGCAAAAGGTGGAGCAGCCATGTTGTCATCAGGCAGTAACAGGTCTGAGGGTAGAA
GCTGCATTCTGATAATACCAGGGAAAAATAATACAAGTAGTCTAGGGCCCAGAGATATCA
CAGATGTCCATTTGAACCCCAAATTACCTGTCTCCAGATTTGCTATCAGGCAAGAAAAGG
AAATCTTTCATTAGTTTAAGCTGTAGTTTACTCCAGTTTTCTATAACTTTCGGCCAGATA
TAACCCTAAATTGACAAAGGGGGCAAGTGCTTAACTGCAAAGCAGTTAAAACTCAAACAC
AGGCCTTCATTTCTTCAGGGTTTTAGTTTTTTCTAGGGAAGAATCTTAACTACTGCTACT
AAAAGTTATAGTAGGCCAGGGATGGTGACTCACGCCTGTAATCTCAGCACTTTGGAAGCC
CAGGCAGGTGGATCACCTGAGGTCAGGAGTTCAAGACCAGCCTGGCCAACGTGGTGAAAC
CCCATCTCTACTAAAAATACAAAAATTAGCCAGGCATGATGGTGCATGCCTGTAGTCACA
CCTACTCAGGAGGCTGAGTCAGGAGAATAGCTTGACCCAGGAGGCAGAGGTGGCAGTGAG
CCAAGATCGCACCACTGCACTCCAGCCTGGGCGACAGAGCAAGACTCTGTCTCAAAAAAA
AAAAAGTCATAATCAAAGAGGAAGACTGAGATAAATGTAGAGTCAAAGGGCTAAACAGAA
ACATAACACATGGGTTTTAAGCTAAGCCTTCACATTATCCCTTATACAATTTTATCTACA
CCGATTTCACCAAAGCTCAAAGTTATATTATTGGCTGAGATTGGCATTGGGATGGAGTGG
TGAAGCTAAGAAATTCGTTATCCCTTTGTTCCAGTGCTGCTGGACTTTTCACTAAGTGAA
GAGGTAAATGCTGAGTCTCCCAGGAGGCTGACTCCTCCTGGCTCTGGGTGTGCATTCTGA
TGAAGGTTCTTTATTGTAGGCACCAACAGAAGGCTCATGAGAGGGCAACATGGATCTCCA
TTTCTGAGCAGATGTTTAAACGCTGAATCAGGTCCAAGGCTTCCCAAATGAACTCAAGGA
GTTTCTTTTTCCCAAGCCATAGAAAGTGGCGATAGCAATCCAGGGTCTGCACTGGGAAGG
AGCACTGCCAGGACACGTCCCTCCCTGCCATTCCCCCACCCTCGCCCAGGAGACGTCCCT
CCCTGCCACCACACAGGACACATCCCTCCTTGCCATCCCACCCCCCTTCCCAGGACACGT
CCCTCCCTGCCATCCCATCCCATTCCCCCACAAGGACACGTCCCTCCCTGTCATCCCACC
CCCCTTCTCAGGACACATCCTTCCCTGCCATCCCACACCCCCCCCAGGACACGTCCCTCC
CTGCCATCCCACGCCTCCCCCCAGGACACATCCCTCCCTGCCATCCCACCCCGCCCCCCA
GGACACACAGGTCCGTGAAATCAGTATAGACACTTGTATCAAGCAAGAAGAAGCATGTTA
CTCAGAAGAACACAATTTTGTTGTTTTGTTTTTGTTTCTGGGTTTTGGTTGTTTTTTTTG
TTTTTTTTTTTGGGGAATTAAACAAATAATTTCAAGTTCTACCTCCACCACCTACCAGCT
GCATGATCTTAGACCATTGACATCACCTCCCTGACCGTGATTTTCACATCTAGAGAATGG
GAGGGGAAGAACCATGCCTTGGGGGCCAGGCTGAGGATGAACTATGAAAACCCGTCCTAT
TGGGCACTCTCGAACAGTCACCATTGTTGGTATGAGGCCCACTATCAGTGAAACTGATTG
AAATTGGTGTACATCTGAGACCTGAGGACAGCCATCAAGTGTCTATTAACTTAAGCTTTA
TGTAGCAAGCATTTATTGCACATGATCCTAGGTCCCAAGTATGCTTCGGTAAATTAAACA
CCCTTGGTCCCTGCCCTCACAAGCCGTTCATAATCTAGACAGATACATAAGATATAAATG
CACAATTGTTCATTGAAAATCTCCGAAGTCACTGGCTATTTTCTGTGGTTCTCGGCACCA
TCACCACCCTTCCAAATTCTCTCCTGTTCTCAGGGGTTAGAAACCTGCAAACTACATTCC
CTAGACTTCCTTGCCTGTAGGAGCAAAATGATCCCATGTATTACTGCGAAATGGTAGTGT
CTGGGTCCCAGAAGACAGTTAGTAGAATCAGAATGTAGGAAAGTGTGTGCCACAGCCACA
CATGTTCATGATAGTCATAACTTGTTCAGTAGGAATTTAGAGAAGACTGACTGTACACAA
GGTATTGCTAAATGCTATGCGGGATACAGAGATGCCTGTGCCTCTAAGAAACTTGGTAGA
AAAATAATAACCCACACATATTTGGCTTACCTTCTCTTTGAATAGAGCAATTGGCAGTTT
AGATTCAGTCATTCTTCAATTCATTTAGCCAAAATTTATTCTGTGATGGCTGAATCCAAC
AAATGAAGTCTCTACTCTCATATTATTTTCCATTTTGTTCCACTGAATTTCAGCAAACAT
AGACCAGACAAGCATCCCTTTGAAACCTGGACTTGGGATGAGGGTCTGCTGAGATTGGGT
TTTCTCCATGCCCAGATGCCTCTGATCAAATATCAAGTCCCAAAGATACAGATGAGAAAG
TTATTAAGTGTTCTGGGATTGGGACATCGGAGATATTAATTAACCCTGGCTTGAGATGGG
AAGAGGGGGCAGGTAGCTTTCTTTGTGTAGTGTTTAGGAAGGTGATTGCCAATCTAGGAG
AAGTGAGTTCCCCAGAGGGAGGGGGGCTCTTGGCCAGCAGGGTGACCCATATGTTCTGGT
CTGCCTGGAGCTGTGGTCCTTGGGTTCACAGCGGCCCCTTTGCACTCAAAGCACCCTAGC
TTGGACAATAAATTCTACAGTCAGTTCTGCAGTGACGATCTTCAATTCCTAGGGCTGCCA
TAAGAGAAGATCATAGACTAGGGGTGGTACACGACAGAAATTCATCTTCTCCCAGTTCTG
GAGCCTGAAAATCCAAAACAAGGTGCTGTCAGGGTTGGATTCTCCTTGGGCCTCTCTTCT
TGGCTTGCAGGTGGCTGTCTTCTGGCTGTGTCCTCGTGTGTCCCCAACATCCCCCTGTGT
GTGTGTGCAACCCTTATGTCTCTTCCTCTGCTCATAAGAAAACAGTCCTATAGGACTAGG
ACCACATTCTTATGGCCTCATTTAACCTTAATTACCTCCTTTAGGGCCCTGTCTCCAAAT
ATGTTCAGTGGAGGTTTGGGGCTTTGGCATATGAGTCTTTGGAGGCCACAGTTCTGTCCA
GAACACACTGACCCTATCCACCAGGTACTGCCACACCAATGGCTTTCAGCATTAGACAGA
GCCCCCCTGGGCTCTGTAACCCCACCCAGGGTGTTAAGAATGAGGAGTGAAAGTCCACAC
ATGTACACACATGTTAATAGCAGCATTATGCGCAACAGTCAAACAGTGGACACACCCAAA
TGCCCATCAGTGGATGATGGATACATGCAAGGTGATTTATCCAGACAGTGGCATCATATT

***

But what if we need something a little more specific? Something that will allow us to listen more deeply into the code that is you?

Glad you asked; here is Piringer’s passwords, in which he has collected 25,727 passwords, displayed one per frame. The longer a password, or part of one, is visible, the more people have used it:

“the sound is my computer reading the beginning of the list sped up to 13% of the original length.” – from the /joerg.piringer.net

***

Intrigued? Hear more:
Joerg Piringer on SoundCloud
Joerg Piringer’s website
Twitter: @jpiringer

Share this Post
Share on FacebookShare on Google+Tweet about this on TwitterShare on LinkedInPin on PinterestShare on Tumblr

Categories

Kudos, Most Visited

What do you think?

Leave a Reply

Your email address will not be published.